Coat protein (CP) sequences of Apple mosaic virus (ApMV) isolates were obtained from apple, plum and hazelnut. These isolates were initially tested by DAS-ELISA. Five out of 38 randomly selected apple, hazelnut and plum trees in Isparta, Düzce and Amasya provinces, respectively were ApMV-infected for determining similarities or differences among Turkish ApMV isolates. The isolates were collected in 2008-2010. Amplification of target regions of selected five isolates was conducted by RT-PCR using coat protein specific primers. PCR products gave bands of 262 bp in gel electrophoresis. Sequence data of 262 bp of the partial coat protein region of the ApMV isolates were obtained using F 5’ AGTAATCCGAAAGGTCCGAATCCGAT 3’ primer. All sequences were compared with ApMV sequences in NCBI and our sequences showed 88-99% similarities with those. Our isolates accession numbers are as follows: HM245753, HM490310, HM490311, HM245751, HM245752. They were located in the same group and it was not seen any differences among them.

Coat protein (CP) sequences of Apple mosaic virus (ApMV) isolates were obtained from apple, plum and hazelnut. These isolates were initially tested by DAS-ELISA. Five out of 38 randomly selected apple, hazelnut and plum trees in Isparta, Düzce and Amasya provinces, respectively were ApMV-infected for determining similarities or differences among Turkish ApMV isolates. The isolates were collected in 2008-2010. Amplification of target regions of selected five isolates was conducted by RT-PCR using coat protein specific primers. PCR products gave bands of 262 bp in gel electrophoresis. Sequence data of 262 bp of the partial coat protein region of the ApMV isolates were obtained using F 5’ AGTAATCCGAAAGGTCCGAATCCGAT 3’ primer. All sequences were compared with ApMV sequences in NCBI and our sequences showed 88-99% similarities with those. Our isolates accession numbers are as follows: HM245753, HM490310, HM490311, HM245751, HM245752. They were located in the same group and it was not seen any differences among them.