___

• Aydın, C., Özcan, M.M., 2007. Determination of nutritional and physical properties of myrtle (Myrtus communis L.) fruits growing wild in Turkey. Journal of Food Engineering 79:453-458.
• Bayram, E., Dündar, O., Ozkaya, O., 2009. Effect of different packaging types on storage of Hicaznar pomegranate fruits. Proceeding of the first international symposium on pomegranate and minor Mediterranean fruits, Adana. Acta Horticulturae 818: 319-322.
• Baytop, A., 1968. Bitkilerimizin yerli adları. İstanbul Eczalık Fakültesi Mecmuası 4:55-57.
• Baytop, T. 1999. Türkiye’de bitkiler ile tedavi geçmişte ve bugün. Nobel Tıp Kitapevleri Ltd. Şti., 2. Baskı. İstanbul, 480 s.
• Ghannadi, A., Dezfuly, N., 2011. Essential oil analysis of the leaves of Persian true myrtle. International Journal of Medicinal and Aromatic Plants. 1(2):48-50.
• Gözlekçi, S., Gübbük, H., 2009. Batı Akdeniz Florasında Yetişen Beyaz ve Mor Mersin Tiplerinin (Myrtus communis L.) Bazı Fiziksel ve Kimyasal Özellikleri ile Mineral Besin Maddesi İçerikleri Yönünden Kıyaslanması. III. Ulusal Üzümsü Meyveler
• Sempozyumu, Sempozyum Programı ve Bildiri Özetleri, 10-12 Haziran, Kahramanmaraş, Sayfa 68. Hacıseferoğulları, H., Özcan, M. M., Arslan, D., Ünver, A., 2012. Biochemical compositional and technological characterizations of black and white myrtle (Myrtus communis L.) fruits. Journal of Food Science and Technology: 49(1): 82Jamoussi, B., Romdhane, M., Abderraba, A., Hassine, B.B., Gadri, A.E. 2005. Effect of Harvest Time on the Yield and Composition of Tunisian Myrtle Oils. Flavour and Fragrance Journal 20: 274-277.
• Karamanoğlu, K.1972. Farmasötik Botanik. Ankara Üniversitesi Eczacılık Fakültesi Yayınları.
• Mulas, M.,Fadda, A., 2004. First Observation on Biology and Organ Morphology of Myrtle(Myrtus communis L.) Flower. Agric. Mediterr. 134: 223-235.
• Özcan, M., Akbulut M., 1998. Mersin (Myrtus communis L.) Meyvesinin Bazı Fiziksel ve Kimyasal Özellikleri. Gıda: 2:121-123.
• Öztürk, M., 1970. İzmir Yöresindeki Myrtus communis, L.'in Eko-fizyolojisi Hakkında Bir İnceleme. Doktora Tezi Ege Üniversitesi Fen Fakültesi, İzmir (Yayınlanmamış).
• Pezhmanmehr, M., Dastan, D., Ebrahimi, S.N., Hadian, J., 2009. Essential oil constituents of leaves and fruits of Myrtus communis L. from Iran. Planta Medica: 75: PJ164.
• Serçe, S., Ercişli, S., Şengül, M., Gündüz, K., Orhan, E., 2010. Antioxidant activities and fatty acid composition of wild grown myrtle (Myrtus communis L.) fruits. Pharmacognosy Magazine 6:21, 9-12.
• Topaloğlu, M., 1987. Antakya Yöresinin Yerli Bitki Adları. İstanbul Eczacılık Fakültesi Mecmuası: 23:97-98.
• Acciarri, N., Rotino, G.L., Tamietti G., Valentino, D., Voltattorni, S., Sabatini E., 2007. Molecular markers for Ve1 and Ve2: Verticillium resistance genes from Italian tomato germplasm. Plant Breeding, 126, 617-621.
• Arens, P., Mansilla, C., Deinum, D., Cavellini, L., Moretti, A., Rolland, S., Schoot, H.V.D., Calvache, D., Ponz, F., Collonnier, C., Mathis, R., Smilde, D., Caranta, C., Vosman, B., 200 Development and evaluation of robust molecular markers linked to disease resistance in tomato for distinctness, uniformity and stability testing. Theoretical and Applied Genetics .2010 Feb;120(3):655-64.
• Barone, A., 2004. Molecular Marker Assisted Selection for Resistance to Pathogens in Tomato. MAS in Plants. http://www.fao.org/biotech/docs/Barone.pdf.
• Castro, A.P. Blanca, J. M. Dı´ez, M.J. Vin˜ als, F.N. 2007. Identification of a CAPS marker tightly linked to the Tomato yellow leaf curl disease resistance gene Ty-1 in tomato. European Journal of Plant Pathology (2007) 117:347–356.
• Collard B.C., Mackill, D.J., 2008. Marker-assisted selection: an approach for precision plant breeding in the twenty-first century. Philosophical Transactions of the Royal Society B: Biological Sciences. 12; 363(1491):557-72.
• Devran, Z.Ü., Elekçioğlu, H., 2004. The screening of F 2 plants for the Root-Knot nematode resistance gene, Mi by PCR in Tomato. Turkish Jour. of Agriculture and Forestry, 253-257.
• Dianese E. C., Fonseca, M.E. Goldbach, R., Kormelink, R., Inoue-Nagata, A. K. Resende, R.O., Boiteux, L.S. 2010. Development of a locus-specific, co-dominant SCAR marker for assisted-selection of the Sw-5 (Tospovirus resistance) gene cluster in a wide range of tomato accessions. Molecular Breeding, (2010) 25:113-142.
• Doyle, J.J., Doyle, J.L., 1990. Isolation of plant DNA from fresh tissue. Focus, 12:13-15.
• El Mehrach K, Mejía L, Gharsallah-Couchane S, Salus MS, Martin CT, Hatimi A, Vidavski F, Williamson V, Maxwell DP (2005) PCR-based methods for tagging the Mi-1 locus for resistance to root-knot nematode in begomovirus-resistant tomato germplasm. Acta Horticulturae, 695:263–270.
• El Mohtar, C.A., Atamian, H.S., Dagher, R.B., Abou-Jawdah, Y., Salus, M.S., Maxwell, D.P., 200 Marker-assisted selection of tomato genotypes with the I-2 gene for resistance to Fusarium oxysporum f. sp. lycopersici race 2. Plant Disease ., 91:758-762. FAO, 2010. http://faostat.fao.org/site/567/DesktopDefault.aspx?PageID=567#ancor
• Foolad, M., 2007. Genome mapping and molecular breeding of tomato. Int J Plant Genomics 2007:Medina-Filho H, Stevens M (1980) Tomato breeding for nematode resistance: survey of resistant varieties for horticultural characteristics and genotype of acid phosphatase. Acta Hort 100:383–391.
• Ji, Y., Betteray, B., Smeets, J., Jensen, K.S., Mejía, L., Scott J.W., Havey, M.J., Maxwell, D.P. 200 Co-dominant SCAR Marker, P6-25, for Detection of Ty-3, Ty-3a, and Ty3b introgressions from three Solanum chilense accessions at 25 cM of Chromosome 6 of Begomovirus- Resistant Tomatoes. Proc Tomato Breeders Table, Tampa, FL, USA. roundtable08.ifas.ufl.edu/Schedule.htm. Kawchuk, L.M, Hachey, J., Lynch, D.R., Kulcsar, F., van Rooijen, G., Waterer, D.R., Robertson, A., Kokko, E., Byers, R., Howard, R.J., Fischer, R., Prüfer, D., 2001. Tomato Ve disease resistance genes encode cell surface-like receptors. PNAS 98:6511–6515
• Kaya, H.B., Tanyolaç, B., 2009. Screening of F3 Segregation Population Lines Revealed by Ty-1 Markers Linked to Resistance Locus of Tomato Yellow Leaf Curl Disease (TYLCD) in Tomato (Lycopersicum. esculentum). International Journal of Natural and Engineering Sciences, 33:149-153.
• Kuklev, M.Y., Fesenko, I.A., Karlov, G.I., 2008. Development of a CAPS Marker for the Verticillium Wilt Resistance in Tomatoes. Russian Journal of Genetics, 2009, Vol. 45, No. 5, pp. 575–579.
• Kumar, P., Gupta, V.K., Misra, A.K., Modi, D.R., Pandey, B.K., 2009. Potential of Molecular Markers in Plant Biotechnology. Plant Omics Journal, 2(4):141-162.
• Langella, R., Ercolano, M.R., L. M. Monti, L.M., Frusciante, L., Barone, A., 2004. Molecular marker assisted transfer of resistance to TSWV in tomato elite lines. Journal of Horticultural Science & Biotechnology, 79(5):806–810.
• Nascimento, I.R., Maluf, W.R., Figueira, A.R., Menezes, C.B., Resende, J.T.V., Faria, M.V., Willian, D., 2009. Marker Assisted Identification of Tospovirus Resistant Tomato Genotypes In Segregating Progenies. Sci. Agric. (Piracicaba, Braz.), v.66, n.3, p.298-303.
• Nogueira Tanksley, S.D., 1983. Molecular markers in plant breeding. Plant Mol Biol Rep 1:3–8.
• Panthee, D.R., Foolad, M.R., 2011. A reexamination of molecular markers for use in markerassisted breeding in tomato. Euphytica, DOI 10.1007 /s10681-011-0544-5.
• Park, Y.H., Lee, Y.J., Kang, J.,Choi, Y.W., Son, B., 2008. Development of gene-based DNA marker for verticillium wilt resistance in tomato. Korean Journal of Horticultural Science & Technology 2008 Vol. 26 No. 3 pp. 313-319.
• Scott, J.W., Agrama, H.A., Jones, J.P., 2004. RFLP-based analysis of recombination among resistance genes to Fusarium wilt races 1, 2 and 3 in tomato. J ournal of the American Society forHorticultural Science 129(3):394–400.
• Simons, G., Groenendijk, J., Wijbrandi, J,, Reijans, M., Groenen, J., Diergaarde, P., Van der Lee, T., Bleeker, M., Onstenk, J., de Both, M., Haring M, Mes, J., Cornelissen, B., Zabeau, M., Vos, P., 1998. Dissection of the Fusarium I2 gene cluster in tomato reveals six homologs and one active gene copy. Plant Cell 10:1055–106.
• Staniaszek, M. , Kozik, E.U., Marczewski, W., 2007. A CAPS marker TAO1902 diagnostic for the I-2 gene conferring resistance to Fusarium oxysporum f. sp. lycopersici race 2 in tomato Plant Breeding 126, 331–333.
• Tanksley, S.D., Ganal, M.W., Prince, J.P., Devicente, M.C., Bonierbale, M.W., Broun, P., Fulton, T.M., Giovannoni, J.J., Grandillo, S., Martin, G.B., Messeguer, R., Miller, J.C., Miller, L., Paterson, A.H., Pineda, O., Roder, M.S., Wing, R.A., Wu, W., Young, N.D., 1992. Highdensity molecular linkage maps of the tomato and potato genomes. Genetics 132:1141– 11
• Şekil 1. Çalışmada kullanılan primerlerden elde edilen PCR ürünlerine ait jel görüntüleri (a: At2FR3, b: Z1063, c: TAO 902 , d: VVF2, e: Ve1YP-F, f: Ve2- SNP 2827, g: Mi-23, h: Pmi, i: JB-1, j: P6-25, k: Sw 5-2)
• Çizelge 1. Çalışmada kullanılan primerler ve dizilimleri Gen Markör Primer Dizini Markör Tipi Kaynak 1 Mi Mi-23 F:5’-TGG AAA AAT GTT GAA TTT CTT TTG -3’ SCAR Seah ve ark., 2007 R:5’-GCA TAC TAT ATG GCT TGT TTA CCC-3’ 2 Mi PMi F:GGTATGAGCATGCTTAATCAGAGCTCTC SCAR El Mehrach ve ark., 2005 R:CCTACAAGAAATTATTGTGCGTGTGAATG 3 Ve2 SNP 2827 Ve2_2720F F:GGATCTTAGCTCACTTTATGTTTTGAAC SCAR Kawchuk ve ark., 2001 Ve2_3040R R: GGTGCTGGTTTCAACTCTGAAGT 4 F. oxysporum At2-F3 F:CGAATCTGTATATTACATCCGTCGT SCAR Scott ve ark., 2004 race 0, I At2-R3 R:GGTGAATACCGATCATAGTCGAG 5 F. oxysporum Z1063F F:ATTTGAAAGCGTGGTATTGC SCAR Simons ve ark., 1998 race 1, I2 Z1063R R: CTTAAACTCACCATTAAATC 6 Sw-5 Sw-5-2 F: 5-AATTAGGTTCTTGAAGCCCATCT-3 SCAR Dianese ve ark., 2010 R: 5-TTCCGCATCAGCCAATAGTGT-3 7 Ve VVF2 5'-GAC TAC ATT GAC CCT GGG CTC TTG-3'; CAPS Kuklev ve ark., 2008 VVR2 5'-TGA GAG CAC CTT AAG CTT TTC AAT-3'). 8 Ve Ve1YP-F F:5’-CTTCCACAATGGCAAACCTTAGA 3’ CAPS Park ve ark., 2008 VeYP-R2 R:5’-TGGGGAAATGTGAAAGAGGT 9 Ty-1 JB-1 F: 5-AACCATTATCCGGTTCACTC-3 CAPS Castro ve ark., 2007 R: 5-TTTCCATTCCTTGTTTCTCTG-3 10 Ty-3 P6-25 F2, 5’ GGT AGT GGA AAT GAT GCT GCT C SCAR Ji ve ark., 2008 R5, 5’ GCT CTG CCT ATT GTC CCA TAT ATA ACC 11 I-2 TAO1 F: 5-GGGCTCCTAATCCGTGCTTCA-3 CAPS Staniaszek, 2007 R 5-GGTGGAGGATCGGGTTTGTTTC-3
• Çizelge 1. 92 adet F 2 domates popülasyonuna ait genotiplerin bazı hastalık ve zararlılara karşı dayanıklılığı sağlayan genlerle ilişkili olarak geliştirilen moleküler markörlerle taranmasından elde edilen sonuçlar Hastalık/ Zararlı Nematod TYLCVD TSWV Fusarium licopersica Verticillium solgunluğu Genler Mi2 Ty-1 Ty–3a Sw-5 I-1 I-2 Ve Markör Mi-23 Pmi JB-1 P6-25 Sw-2 At2-FR3 TAO902 Z1063 VVF2 Ve1YP-F SNP 2827 Beklenen (B)/
• Gözlenen (G) B G B G B G B G B G B G B G B G B G B G B G HM Dayanıklı 23 25 23 25 23 24 23 26 23 20 23 21 23 21 21 20 Heterezigot 46 48 46 48 69 64 46 50 46 43 69 66 46 47 69 73 46 49 46 49 46 49 HM Hassas 23 19 23 19 23 266 23 18 23 23 23 26 23 25 23 19 23 19 23 19 19 20 Toplam 92 92 92 92 92 92 92 92 92 92 92 92 92 92 92 92 92 92 92 92 92 92 Açılım Oranı 01:02:01 01:02:01 03:01 01:02:01 01:02:01 03:01 01:02:01 03:01 01:02:01 01:02:01 01:02:01 X 2 Testi 0,956 0,956 0,753 1,478 0,586 0,521 0,586 0,927 1,065 1,065 1,065 X 2 , 1:2:1 hipotezi için S.D=2, 3:1 hipotezi için SD=1, %1 için 6.63, %5 için 3.84 HM Hassas: Homozigot Hassas (Duyarlı), HM Dayanıklı: Homozigot Dayanıklı, Heterezigot: Heterezigot Dayanıklı Aghdam, M.S., Motallebiazar, A., Mostofi, Y., Moghaddam, J.F., Ghasemnezhad, M., 2010. Effects of MeSA Vapor Treatmet on the Postharvest Quality of ‘Hayward’ Kiwifruit. Acta Horticulturae 877: 743-748.
• Al-Qurashi, A., Awad, M.A., 2012. Postharvest Salicylic Acid Treatment Reduces Chilling Injury of ‘Taify’ Cactus Pear Fruit during Cold Storage. Journal of Food, Agriculture & Environment. 10 (2): 120-124.
• Anonim, 2012. FAO Agricultural Statistical Database. http://faostat.org.
• Asghari, M., Aghdam, M.S., 2010. Impact of Salicylic Acid on Postharvest Physiology of Horticultural Crops. Trends in Food Science & Technology. 21: 502-509.
• Bal, E., Celik, S., 2010. The Effects of Postharvest Treatments of Salicylic Acid and Potassium Permanganate on the Storage of Kiwifruit. Bulgarian Journal of Agricultural Science. 16(5):576-584.
• Ding, C.K., Wang, C.Y., Gross, K.C., Smith, D.L., 2001. Reduction of Chilling Injury and Transcript Accumulation of Heat Shock Protein Genes in Tomatoes by Methyl Jasmonate and Methyl Salicylate. Plant Science. 161: 1153-1159.
• Dündar, Ö., Özkaya, O., 2006. Derim Sonrası 1-Methylcyclopropene (1-MCP) Uygulamalarının ‘Granny Smith’ ve ‘Fuji’ Elmalarında Kalite Üzerine Etkileri, TÜBİTAK-TOVAG-3249 Proje Sonuç Raporu.
• Kader, A.A., 2002. Postharvest Technology of Horticultural Crops, University of California Agriculture and Naturel Resources, Publication 3311.
• Kazemi, M., Aran, M., Zamani, S., 2011. Effects of Salicylic Acid Treatments on Quality Characteristics of Apple Fruits during Storage. American Journal of Plant Physiology. 6(2): 113Luo, Z., Chen, C., Xie, J., 2011. Effect of Salicylic Acid Treatment on Alleviating Postharvest Chilling Injury of ‘Qingnai’ Plum Fruit. Postharvest Biology and Technology. 62: 115-120.
• McGuire, R.G., 1992. Reporting of Objective Color Measurements. HortScience, 27 (12): 125412
• Mo, Y., Gong, D., Liang, G., Han, R., Xie, J., Li, W., 2008. Enhanced Preservation Effects of Sugar Apple Fruits by Salicylic Acid Treatment during Post-harvest Storage. Journal of the Science of Food and Agriculture. 88: 2693-2699.
• Özeker, E., 2005. Salisilik Asit ve Bitkiler Üzerindeki Etkileri. Ege Üniversitesi Ziraat Fakültesi Dergisi, 42(1): 213-223.
• Özer, M.H., 2002. Elma Çeşidinin Kontrollü Atmosferde (KA) Muhafazası. Uludağ Üniv. Ziraat Fakültesi Dergisi, 16(2): 189-202.
• Sayyari, M., Babalar, M., Kalantari, S., Serrano, M., Valero, D., 2009. Effect of Salicylic Acid Treatment on Reducing Chilling Injury in Stored Pomegranates. Postharvest Biology and Technology. 53:152-154.
• Srivastava, M.K., Dwivedi, U.N., 2000. Delayed Ripening of Banana Fruit by Salicylic Acid. Plant Science. 158: 87-96.
• Tareen, M.J., Abbasi, N.A., Hafız, I.A., 2012. Effect of Salicylic Acid Treatments on Storage Life of Peach Frutis cv. ‘Flordaking’. Pakistan Journal of Botany. 44(1): 119-124.
• Zhang, Y., Chen, K., Zhang, S., Ferguson, I., 2003. The Role of Salicylic Acid in Postharvest Ripening of Kiwifruit. Postharvest Biology and Technology 28: 67-74.
• Anonim, 2011. http://www.fao.org/corp/statistics/en/.
• Anonim, 2012. http://www.tuik.gov.tr.
• Eliwa, G.I., Ashour, N.E., Ali, M.M., 2003. Effect of Girdling and Foliar Application with Some Sources of Potassium and Calcium on Fruit Drop, Yield and Fruit Quality of Persimmon Trees. Egyptian Journal of Horticulture, 30(3/4): 239-251.
• Evrenosoğlu, Y., Acarsoy, N., Mısırlı, A., 2011. Investigations on Fertilization Biology and Description of Fruit Characteristics of Some Persimmon (Diospyros kaki) Cultigens. African Journal of Agricultural Research, 6(6): 1383-1392.
• George, A.P., Nissen, R.J., Mowat, A., Collins, R.J., 2003. Innovative Production Systems for Non-astringent Persimmon. Acta Horticulturae, 601: 151-157.
• Hasegawa, K., Kuge, N., Mimura, T., Nakajima, Y., 1991. Effects of KT-30 and GA3 on the Fruit Set and the Fruit Growth of Persimmon cvs. Saijo and Hiratanenashi. Journal of the Japanese Society for Horticultural Science, 60(1): 19-29.
• Heslop-Harrison, J., Heslop-Harrison, Y., 1970. Evaluation of Pollen Viability by Enzymatically Induced Flourescence: Intracelular Hydrolysis of Fluorescein Diacetate. Stain Technology, 45(3): 115-120.
• Kitajima, A., Akuta, H., Yoshioka, T., Entani, T., Nakano, M., Ishida, M., 1992. Influence of Seeded Fruit on Seedless Fruit Set in Japanese persimmon cv. Fuyu (Diospyros kaki L.). Journal of the Japanese Society for Horticultural Science, 61(3): 499-506.
• Krisanapook, K., Sillapapetch, K., Phavaphutanon, L., Jutamanee, K., 2004. Improvement of Fruit Set and Fruit Qualities in Persimmon ‘Fuyu’ using Pollination. Acta Horticulturae, 662: 119-123.
• Lee, Y.M., Park, H.T., Lee, Y.J., 1998. Effects of Pollinizer on Fruit Drop and Quality of 'Fuyu' Persimmon. Journal of the Korean Society for Horticultural Science, 39(5): 533-536.
• Matos, C.S., 1997. The Efect of Pollination on the Physilogy, Composition and Formation of Persimmon Fruits. Agropecuária Catarinense, 10(2): 5-7.
• Messaoudi, Z., Gmili, R. E., Khatib, F., Helmy, Y., 2009. Effect of Pollination, Fruit Thinning and Gibberellic Acid Application on “Fuyu” Kaki Fruit Development. Acta Horticulturae, 833: 233-238.
• Norton, J. D., 1966. Testing of Plum Pollen Viability with Tetrazolium Salts. Proceedings of the American Society for Horticultural Science, 89: 132-134.
• Ping, L., Hailong, W., Wen, Y., 2003. Problems on Introducing Fine Sweet Persimmon Varieties to Persimmon Growing Areas in Northern China. Journal of China Agricultural University, 8(1): 55-58.
• Sağır, F.S., Karabıyık, Ş., Eti, S., Yılmaz, B., 2012. Seçilmiş Bazı Yerli Trabzon Hurması (Diospyros kaki L.) Tipleri İçin Uygun Tozlayıcı Çeşit Belirlenmesi. Derim, 29(2): 58
• Sayılıkan, G., 1995. Bazı Yerli ve Yabancı Trabzon Hurması Çeşitlerinin Döllenme Biyolojisi Üzerine Araştırmalar. Çukurova Üniversitesi Fen Bilimleri Enstitüsü Yüksek Lisans Tezi, 143 s. (Yayınlanmamış).
• Sugimura, T., Wakisaka, M., Imagawa, J., 2005. Effects of Gibberellic Acid Application on Fruit Set and Fruit Quality of Japanese Persimmon cv. Shinsyuu under Forced Culture. Bulletin of the Nara Prefectural Agricultural Experiment Station, 36: 1-6.
• Tuzcu, Ö., Yıldırım, B., 2000. Trabzon Hurması (Diospyros kaki L.) ve Yetiştiriciliği. TÜBİTAK, Türkiye Tarımsal Araştırma Projesi Yayınları, Adana, 24s.
• Yakushiji, H., Yamada, M., Yonemori, K., Sato, A., Kimura, N., 1995. Staminate Flower Production on Shoots of “Fuyu” and “Jiro” Persimmon (Diospyros kaki) Journal of the Japanese Society for Horticultural Science, 64: 41-46.
• Yakushiji, H., Nakatsuka, A., 2007. Resent Persimmon Research in Japan. Japanese Journal of Plant Science, 1/2: 42-62.
• Yano, T., Moriguchi, K., Shinkai, S., 1999. Investigation on the Control of Physiological Fruit Dropping in the “Tonewase” Japanese Persimmon (1). Efeects of Plant Growth Regulators and Girdling on Fruit Set and Fruit Quality. Bulletin of Ehime Fruit Tree Experiment Station, 13: 11-18.
• Yıldız, E., Kaplankıran, M., 2007. Hatay İli Trabzon Hurması Seleksiyonunda Belirlenen Tiplerin Özellikleri. Türkiye V. Ulusal Bahçe Bitkileri Kongresi, 4-7 Eylül 2007, Erzurum, s.266-270.
• Yıldız, E., Kaplankıran, M., 2012. Variation in Some Growth, Fruit Yield and Quality Characteristics of Different Persimmon Cultivars in Dörtyol-Hatay (Turkey). The Fifth International Symposium on Persimmon, 20-26 Ekim 2012, Wuhan, China.
• Zhou, R.J., Hu, H.L., Li, G.R., Miao, W.D., 2009. Studied on Characteristics of Pollen Germination and Storage of Sweet Persimmon. Chinese Agricultural Science Bulletin, 25/2: 176-179.
• Brown W.W., Ormrod, D.P., 1980. Soil temperature effects on greenhouse roses in relation to air temperature and nutrition. J. Amer. Soc. Hort. Sci. 105(1): 57 - 59.
• De Jong, J., 1978. Dry storage and subsequent recovery of cut gerbera flowers, an aid in the selection for longevity. Scientia Hort. 9: 389-397.
• De Vries D.P., Smeets, L., 1979. Effects of temperature on growth and development of hybrid tea-rose seedlings. ScientiaHortic. 11: 261 - 268.
• De Vries D.P., Smeets, L., Dubois, Lidwien A.M., 1980. Genetic variation for the time of first flower and shoot length in hybrid tea-rose seedling populations under a range of temperatures. ScientiaHorti., 13: 61 - 66.
• De Vries D.P., Smeets, L., Dubois, Lidwien, A.M., 1982. Interaction of temperature and light on growth and development of hybrid tea-rose seedlings, with reference to breeding for low-energy requirements. ScientiaHorti., 17: 377 - 382.
• Karlsson, M.G., Heins, R.D., Erwin, J.E., Berghage, R.D., Carlson, W.H., Biernbaum, J.A., 19 Irradiance and temperature effects on time of development and flower size in chrysanthemum. Scientica Horticulturae, vol. 39, issue 3, pages 257 - 267. Marcelis-van Acker, C.A.M., 1994. Axillary bud development in rose. Dissertation Agric. Univ. Wageningen, The Netherlands. 131pp.
• Marcelis-van Acker, C.A.M., 1995. Effect of temperature on development and growth potential of axillary buds in roses. Sci. Hortic.63: 251-261.
• Moe, R., Kristoffersen, T., 1969. The effect of temperature and light on growth and flowering of Rosa ‘Baccara’ in greenhouses.ActaHortic. 14: 157 - 163.
• Moe R., 1972a. Effect of day length, light intensity, and temperature on growth and flowering in roses. J. Am. Soc. Hort. Sci. 97: 796 - 800.
• Moe, R., 1973. Propagation, growth and flowering of potted roses. Acta Hortic. 33: 35-50.
• Porter, J.R., Delecolle, R., 1988. Interaction of temperature with other environmental factors controlling the development of plants. In: Plants and temperature (S.P. Long & F.I. Woodward, eds). Symp. Soc. Exp. Biol. 42. Company of Biologists, Cambrige, pp. 1331
• Van den Berg, G.A., 1987. Influence of temperature on bud-break, shoot growth, flower bud atropy and winter production of glasshouse roses. Dissertation Agric. Univ. Wageningen, 170pp.
• Anonim, 2002. Citrus Important from The Arab Republic of Egypt. A Review Under Existing Import Conditions for Citrus from Israel. Biosecurity, Agriculture Fisheries and Forestry, Australia, 97-102. Web page: http://www.daff.gov.au.
• Anonim, 2005. Pomegranate, Major Pomegranate Pests in The Middle East. Web page: http://www.agri.huli.ac.il.
• Anonim, 2009. T.C. Başbakanlık Türkiye İstatistik Kurumu (TUİK), Bitkisel Üretim İstatistikleri, Ankara. Web page: http://www.tuik.gov.tr.
• Anonim, 2010. Citrus Pests. UC IPM Online Statewide Integrated Pest Management Program: Insects, Mites and Snails. Agriculture and Natural Resources, Universty of California. Web page: http://www.ipm.ucdavis.edu.
• Avidov, Z., Gothilf, S., 1960. Observation on Honeydew Moth (Cryptoblabes gnidiella Mill.). Israel J. Agr. Res. 10 (3-4): 109-124.
• Blumenfeld, A., Shaya, F., Hillel, R., 2007. Cultivation of Pomegranate. CIHEAM-Options Mediterraneennes. Institute of Horticulture, Agricultural Research Organization, The Volcani Center, Israel. Web page: http://ressources.ciheam.org.
• Bodenheimer, F.S., 1951. Citrus Entomology in The Middle East (The Honeydew moth, Cryptoblabes gnidiella Mill.) with Special References to Egypt, Iran, Irak, Palestine, Syria and Turkey. 55-58.
• Bodenheimer, F.S., 1958. Türkiye’de Ziraate ve Ağaçlara Zararlı Olan Böcekler ve Bunlarla Savaş Hakkında Bir Etüt. Bayur Matbaası, Ankara, 347 s.
• Ertürk, H., 1963. Batı Anadolu İncirlerinde Zarar Yapan Lepidopter’lerden Phycitidae Familyası Türleri ve Bunlardan İncir kurdu (Ephestia cautella Walk.)’nun Biyolojisi, Zarar Şekli ve Mücadele İmkanları Üzerinde Çalışmalar. Tarım Bakanlığı, Bornova Zirai Müc. Araşt. Enst. Yayınları No: 9, 117 s.
• İren, Z., Ahmed, M.K., 1973. Türkiye’nin Microlepidopter’leri ve Meyve Zararlıları (I. ve II. Kısım). Bitki Koruma Bülteni, Ek Yayın (1): 96 s.
• Juan, P., Martinez, J., Martinez, J.J., Oltra, M.A., Ferrandez,M. 2004. Current Situation of Pomegranate Growing (Punica Granatum L.) in Southern Alicante. Chemical Control of Pests and Diseases and Financial Cost. Web page: http://ressources.ciheam.org
• Kashkuli, A., Eghtedar, E., 1976. Biology and Ecology of Spectrobates ceratoniae (Zell.) (Lepidoptera: Pyralidae) in the Province of Fars. Ent. Phyt. Applig., 41: 21–32.
• Mart, C., 1992. Güneydoğu Anadolu Bölgesi’nde Nar (Punica granatum L.)’larda Zararlı Harnup güvesi, Ectomyelois ceratoniae Zeller (Lep.: Pyralidae)’nin Bio-Ekolojisi ve Mücadelesi Üzerinde Araştırmalar. Ankara Ünv. Fen Bilimleri Enstitüsü, Bitki Koruma Anabilim Dalı, Ankara, 131 s.
• Mart, C., Altın, M. 1992. Güneydoğu Anadolu Bölgesi Nar Alanlarında Belirlenen Böcek ve Akar Türleri. Türkiye II. Entomoloji Kongresi Bildirileri, 28-31 Ocak 1992, Adana, s.: 725-7
• Moore, S.D., 2003. The Lemon Borer Moth: A New Citrus Pest in South Africa. SA Fruit Journal, 2 (5): 37-41.
• Özkan, A., Akteke, Ş., Keleş, A., Türkyılmaz, N., Zeren, G., Kumaş, F., Tuncer, E., Damdere, H., 1991. Turunçgil Hastalık ve Zararlıları. T.C. Tarım ve Köyişleri Bakanlığı Narenciye Araşt. Enst. Müdürlüğü, Antalya, Genel Yayın:15, Teknik Yayın:9, 120 s.
• Öztop, A., Kıvradım, M., Tepe, S., 2002. Antalya İli Nar Üretim Alanlarında Bulunan Zararlılar ile Bunların Parazitoitlerinin ve Predatörlerinin Belirlenmesi ve Popülasyon Değişiminin İzlenmesi. T.C. Tarım ve Köyişleri Bakanlığı, Tarımsal Araştırmalar Genel Müd., Ankara. Proje no: Bs-99-06-09-130, Sonuç Raporu (Yayınlanmamış), 16 s.
• Öztürk, N., Ulusoy, M.R., Bayhan, E., 2005. Doğu Akdeniz Bölgesi Nar Alanlarında Saptanan Zararlılar ve Doğal Düşman Türleri. Türk. Entomol. Derg., 29 (3): 225-235.
• Öztürk, N., Pala, H., 2008. Nar Hastalık ve Zararlıları. T.C. Tarım ve Köyişleri Bakanlığı, Koruma ve Kontrol Genel Müdürlüğü, Ankara, 48 s.
• Öztürk, N., Ulusoy, M.R., 2009. Pests and Natural Enemies Determined in Pomegranate Orchards in Turkey. I. Int. Symposium on Pomegranate and Minor Mediterranean Fruits, 16-19 October 2006, Adana-Turkey. Acta Hort., 818: 277-284.
• Öztürk, N., 2010. Doğu Akdeniz Bölgesi Nar ve Turunçgil Alanlarında Zararlı Portakal güvesi, Cryptoblabes gnidiella Mill. (Lepidoptera: Pyralidae)’nın Mücadelesine Esas Bazı
• Biyolojik Özelliklerinin Belirlenmesi. Ç. Ünv. Fen Bilimleri Enstitüsü, Bitki Koruma Anabilim Dalı, Balcalı, Sarıçam-Adana, 108 s. Singh, Y.P., Singh, D.K., 1995. Bionomics of Cryptoblabes gnidiella Mill. A Pest of Sorghum. Advances in Agricultural Research in India, 3: 119-129.
• Toledo J., Albujer, E., 2005. Project of Technical Standards for Pomegranate Integrated Production in Valencia. Web page: http://ressources.ciheam.org.
• Uygun, N., Ulusoy, M.R., Karaca, İ., Satar, S., 2010. Meyve ve Bağ Zararlıları. Ç.Ü. Ziraat Fakültesi Ders Kitapları, Özyurt Matbaacılık, Adana, 347 s.
• Anonim, 1992. Grape Pest Management (Second edition). Unv. of California Division of Agriculture and Natural Resources, Oakland, California, 400 pp.
• Anonim, 2010. T.C. Başbakanlık Türkiye İstatistik Kurumu, Bitkisel Üretim İstatistikleri, Ankara. http://www.tuik.gov.tr.
• Anonim, 2011. Bağ Entegre Mücadele Teknik Talimatı. T.C. Gıda, Tarım ve Hayvancılık Bakanlığı, Tarımsal Araştırmalar ve Politikalar Genel Müdürlüğü, Bitki Sağlığı Araştırmaları Daire Bşk., Ankara, 155 s. http://www.gkgm.gov.tr.
• Çakırbay, İ.F., Alıcı, H., Bozbek, Ö., 2000. Erzincan İli Bağlarında Zararlı ve Faydalı Böcek Türlerinin Tespiti Üzerine Araştırmalar. T. C. Tarım ve Köyişleri Bakanlığı Tarımsal Araştırmalar Genel Müd., Erzincan Bahçe Kült. Araşt. Enst. Md., Proje: BS/97/06/09/116 (Sonuç raporu), 16 s.
• Çelik, H., Ağaoğlu, Y.S., Fidan, Y., Maraşalı, B., Söylemezoğlu, G., 1998. “Genel Bağcılık”. Sunfidan A. Ş. Mesleki Kitaplar Serisi: 1, Fersa Matbaacılık San. Tic. Ltd. Şti., Kızılay/Ankara, 253 s.
• Erkılıç, L., Mart C., Yiğit, A., 1995. Güney Anadolu Bölgesi Bağ Alanlarında Entomolojik Sorunlar ve Çözüm Önerileri. GAP Bölgesi Bitki Koruma Sorunları ve Çözüm Önerileri Simpozyum Bild., 27-29 Nisan 1995, Şanlıurfa, 296-303.
• Günaydın, T., 1972. Güneydoğu ve Doğu Anadolu Bölgelerinde Bağ Zararlıları Üzerinde Sürvey Çalışmaları. Zir. Müc. Araşt. Yıllığı, s.: 42.
• İren, Z., 1976. Orta Anadolu Bölgesi Önemli Bağ Zararlıları. Bitki Koruma Bülteni, 16 (4): 201-2
• Kaplan, C., Çınar, M., 1998. Güneydoğu Anadolu Bölgesi Bağlarında Ana ve Ekonomik Öneme Sahip Zararlılar ile Yararlıların Yıllık Populasyon Değişimleri ve Zararlıların Mücadeleye Esas Kritik Biyolojik Dönemlerinin Saptanması. http://web.ttnet.com.tr
• Kovancı, B., Türkmen, C., Kumral, N.A., 2005. İznik (Bursa) İlçesindeki Bağlarda Zararlı Salkım güvesi, Lobesia botrana (Den.-Schiff.) (Lep.: Tortricidae)]’nin Ergin Popülasyon Dalgalanması Üzerinde Araştırmalar. 6. Türkiye Bağcılık Sempozyumu, 19-23 Eylül 2005/Tekirdağ, Cilt: 1, 289-296.
• Maçan, S., 1984. Güney Doğu Anadolu Bölgesinde Bağlarda Zarar Yapan Böcek Türleri, Önemlilerinin Tanınmaları, Yayılışları ve Ekonomik Önemleri Üzerinde İncelemeler. T. C. Tarım Orman ve Köyişleri Bakanlığı Zirai Müc. ve Zirai Karantina Gn. Md. Diyarbakır Bölge Zir. Müc. Araşt. Enst. Md. Yayın no: 3, 47 s.
• Özbek, H., Güçlü, Ş., Hayat, R. Yıldırım, E., 1995. Meyve, Bağ ve Bazı Süs Bitkileri Zararlıları. Atatürk Üniversitesi. Ziraat Fak. Yayınları, Erzurum, 357 s.
• Özpınar, A., Albayrak, A., Görür, S.E. 2004. Çanakkale İli Bağ Alanlarında Salkım güvesi [Lobesia botrana Den.& Schiff. (Lepidoptera: Tortricidae)]’nin Populasyon Gelişmesi ve Döl Sayısının Belirlenmesi. Türkiye I. Bitki Koruma Kongresi Bildiri Özetleri, 08-10 Eylül 2004, Samsun, s.: 101.
• Öztürk, N., Hazır, A., Ulusoy, M.R., 2005. Türkiye Bağlarında Saptanan Zararlı Türler ile Doğal Düşmanlar. Türkiye 6. Bağcılık Sempozyumu Bildirileri, 19–23 Eylül 2005, Tekirdağ, Cilt: 2, 575-588.
• Öztürk, N., Acıöz, S., 2010. Tarsus (Mersin) Bağlarında Zararlı Salkım güvesi [Lobesia botrana Den.&Schiff. (Lepidoptera: Tortricidae)]’nin Ergin Popülasyon Değişimi. Bitki Koruma Bülteni, 50 (3): 111-120.
• Alston, J.M., Pardey, P.G., Smith, V.H., 1998. Financing Agricultural R&D in Rich Countries What's Happening and Why The Australian Journal of Agricultural and Resource Economics, 42,1, pp. 51–82.
• ASTI, 2012. http://www.asti.cgiar.org/data/ (Erişim Tarihi: 03.04.2012)
• Beintema, N., Eliot, H., 2009. Setting Meaninful Investment Tar-Gets in Agricultural Research and Development: Challenges, Opportunities and Fiscal Realities, Rome.
• Huang, J., 2012. China: Feeding a billion people. In 2011 Global Food Policy Report. Edited by the International Food Policy Research Institute. Washington, DC.
• OECD, 2012. http://stats.oecd.org/ (Erişim Tarihi: 14.05.2012)
• Roseboom, J., . Pardey, P. G., 1993. Statistical brief on the national agricultural research system of Botswana. Statistical Brief 4. The Hague: International Service for National Agricultural Research.
• Stads G.J., Beintema, N.M., 2009. Public Agricultural Research in Latin America and the Caribbean, Investment and Capacity Trends, Investment and Capacity Trends, ASTI Synthesis Report, p.2-16.
• TUİK, 2012. http://www.tuik.gov.tr/VeriBilgi.do?alt_id=8 (Erişim Tarihi: 01.11.2011)