___

• COI LepF ATTCAACCAATCATAAAGATATTGG Foottit et al., 2008 LepR TAAACTTCTGGATGTCCAAAAAATCA
• COII 2993+ CATTCATATTCAGAATTACC Normark, 1999 A3772 GAGACCATTACTTGCTTTCAGTCATCT
• EF-1α EF3 GAACGTGAACGTGGTATCAC von Dohlen et al., 2002 EF2 ATGTGAGCAGTGTGGCAATCCAA
• LWO OPSETF1 GGYRTYACNATTTTYTTCTTRGG Ortiz-Rivas et al., 2010 OPSETR1 GANCCCCADATYGTNAATAAYGG
• Alignment and multisequence properties The chromatograms obtained from sequencing were edited and assembled using SEQMAN-II, one of the applications in DNASTAR 5.0 (DNASTAR, Madison, WI, USA). For nuclear genes, introns are not appropriate for phylogenetic analysis, and so intron-splicing was applied based on the GT-AG rule along with reference cDNA segments from species of Eriosomatinae (GenBank accession numbers DQ493839 and AM996856 for EF-1α and LWO, respectively). Mitochondrial sequences were also translated into amino acid sequences to check for the presence of termination codons (usually UGA for eukaryotes) to avoid the introduction of pseudogenes. It was notable that either 1 or 2 of the 4 genes was not present in a few samples, although this did not negatively impact the analysis. Multiple alignments for each gene were conducted using the accessory CLUSTAL-W application in BIOEDIT 0 (Hall, 2004). The aligned data were then imported into MEGA 4.0 (Tamura et al., 2007) for analyses of the nucleotide composition, phylogenetically informative sites, and distances between species. Additionally, the saturation of the third codon position for each gene was tested in
• DAMBE 3.8 via an implemented method and transition/ transversion plots (Xia and Xie, 2001; Xia et al., 2003).
• Molecular phylogenetic analysis Before the 4 genes were combined, analyses of singlegene datasets were conducted through different methods. In the 4-gene-combined analyses, which were assigned as the major studies, the datasets were partitioned into genes through the BI method, but concatenated to form a sequential supergene through the analyses using the MP and the ML algorithms. The MP analysis was performed with PAUP* 4.0b10 (Swofford, 2003), with all sites weighted equally, gaps treated as missing data, 1000 random-addition sequences, and tree bisection reconnection branch-swapping. After a 50% majority-rule consensus tree (con-tree) was yielded, a nonparametric bootstrap test was performed with 1000 pseudoreplicates under a heuristic search strategy and 100 random-addition sequences in each pseudoreplicate to examine the topology.
• Before we carried out the analyses of ML and BI methods, the most appropriate nucleotide substitution models for each gene were estimated using JMODELTEST 0.1.1 (Posada, 2008) under the Akaike information criterion and the Bayesian information criterion, respectively. The ML analysis was conducted in PHYML 3.0 (Guindon et al., 2010) under a custom model with optimized nucleotide frequencies, substitution rates, and gamma distribution.
• The tree topology was optimized based on the nearest neighbor interchange and subtree prune and regraft search strategies using 5 random starting trees obtained from NJ estimation. A nonparametric bootstrap test was then performed with 100 replicates to examine the tree topology. BI analysis was performed with MRBAYES 3.1.2 (Ronquist and Huelsenbeck, 2003). The models and parameters for each gene were unlinked, while the topologies were linked during the analysis. Two separate reactions with 4 chains (3 heated chains and 1 cold chain) were run with a random starting tree, and it proceeded for 10 million Markov chain Monte Carlo (MCMC) generations with sampling every 1000 generations until the average standard deviation of the split frequencies became lower than 0.01. Of the 10,001 total trees sampled in each reaction, 2500 trees were discarded as burn-in samples. The remaining trees were used to generate a 50% majority-rule con-tree, in which the percentage given on a node or branch indicates the posterior probability. All of the yielded trees were browsed and edited with FIGTREE 1.3.1 (Rambaut, 2009).
• In addition to the major studies, 5 separate analyses were implemented with 1 of the 5 subfamilies as the out-group while the others were excluded, including Hormaphidinae, Phloeomyzinae, Anoeciinae, Mindarinae, and Thelaxinae. This was assigned as the test of the out-group, which was intended to examine the actual position of each outgroup and the stability of the paraphyletic topology of the subfamily Eriosomatinae obtained in the major studies. Trees were rooted by Adelgidae and Phylloxeridae. Results Sequence characteristics For all samples, the sequenced segments of COI, COII, EF1α, and LWO were approximately 700, 800, 1100, and 870 bp, respectively. After alignment and splicing, the partial sequences of Leu-tRNA were discarded, and the sequences of COI, COII, EF-1α, and LWO were 680, 672, 762, and 543 bp, respectively. The total length of the combined dataset was 2657 bp. All sequences were submitted to GenBank and the accession numbers are listed in the Appendix. Among the combined 2657-bp dataset of the in-groups, 1634 bp were conserved, 1023 bp were variable, and 835 bp were parsimony-informative. When aligned with out-groups, there were 1495 bp of conserved, 1162 bp of variable, and 953 bp of parsimony-informative sites. Additionally, the average base frequencies were 34.9% T, 16.0% C, 33.4% A, and 7% G for in-groups and 34.7% T, 16.2% C, 33.3% A, and 8% G for out-groups. Information on the datasets and statistics for the sequences are listed below in Table 2.
• Reconstructed phylogenies According to the results based on single-gene datasets, there were no clear resolutions higher than the subtribe category and the in-group together with some out-groups formed a comb-like topology. Additionally, the nodal supports from the results based on LWO were relatively higher than those of the other 3 genes. It was worth noting that the bootstrap tests were quite time-consuming when run with single-gene datasets. However, the results of the major studies were much better. MP analysis yielded 14 most parsimonious trees (MPTs). The consistency index value was 0.275 and the retention index was 0.536. The topologies of the 14 MPTs were almost identical (Figure 2) and the out-groups of Mindarinae and Thelaxinae were inserted into the ingroup between Eriosomatini and the other 2 tribes, while the in-group clustered into 3 clades corresponding to the 3 tribes (Eriosomatini, Pemphigini, and Fordini). The nonparametric bootstrap test sampled 7439 trees, and the 50% majority-rule con-tree showed a similar topology to the MPTs, except that Hormaphidinae and Anoeciinae were also inserted into the in-group and a comb-like topology was present. The bootstrap values within each tribe were relatively high, but those of the node E-root and the node O+P+F were low. The ML tree yielded the “GTR+I+Γ” custom model, and the estimated substitution rates were 6.8692 (A-C), 7.9478 (A-G), 1693 (A-T), 4.2327 (C-G), 67.3953 (C-T), and 1.0000
• (G-T). The Γ shape parameter was equal to 0.663, and the proportion of invariant sites was 0.466. The ML topology was quite similar with the MPTs, but Hormaphidinae and Anoeciinae were also inserted into the in-group. The ML con-tree also showed a comb-like topology (Figure 3), because the bootstrap values for the node E-root and the node O+P+F were also low. The topology of the BI tree was similar to that of the MPTs and ML tree, except that some out-groups were clustering together. However, the Bayesian tree exhibited much higher values of nodal posterior probabilities. According to the final con-tree (Figure 4), Pemphigini first clusters with Fordini and then clusters with some out-groups, but the nodal support values are not high. Eriosomatini clusters near the root with low nodal supports. Thus, Eriosomatinae forms a large paraphyletic group with the out-groups. However, the three tribes of the subfamily Eriosomatinae each form a monophyletic group with high nodal supports. The monophyletic clades of subtribes, such as Fordina and Melaphidina, are also presented with high supports. It is worth noting that Formosaphis clustered at the root part of the Pemphigini clade. Furthermore, among the 5 separate analyses of the test of the out-group, only that with Phloeomyzinae showed the monophyly of Eriosomatinae, and the nodal supports for the clade of the in-group were 1/100/87 (BI/ML/MP). However, the other 4 analyses showed the paraphyly of Eriosomatinae, and the corresponding out-group was inserted into the in-group between Eriosomatini and the other 2 tribes (Hormaphidinae and Anoeciinae) or between Fordini and Pemphigini (Mindarinae and Thelaxinae). The basal node supports through BI/ML/MP methods are presented in Table 3. It is worth noting that the node P did not exist in some analyses when Formosaphis clustered in parallel with Fordini, the other Pemphigini taxa, and outgroups (Mindarinae and Thelaxinae). However, the other Pemphigini taxa formed a monophyletic group in most trees with high nodal supports. Discussion Eriosomatinae is not monophyletic All the trees obtained in the analyses with single-gene datasets were totally comb-like, which was similar to previous results based on single-gene datasets (von Dohlen and Moran, 2000; Martínez-Torres et al., 2001). This would be due to the powerlessness of single-gene datasets, rather than the species tree originally being comb-like, whereby thus the nodal supports would be totally poor. Meanwhile, the support values in the major studies based on multigene datasets were significantly improved, especially within each subtribe. It was interesting that the 14 MPTs obtained were almost identical, which provided valuable references for the actual positions of the related out-groups on the phylogeny. Comparing the tree topologies from the major studies through BI/ML/MP reconstructions, it was concluded that the positions of some out-groups were flexible. Mindarinae and Thelaxinae were constantly inserted into the in-group, which suggested that the monophyly of Eriosomatinae might be in doubt. However, Blackman RL, Eastop VF (1994). Aphids on the World’s Trees: An Identification and Information Guide. Wallington, UK: CAB International.
• Dunn CW, Hejnol A, Matus DQ, Pang K, Browne WE, Smith SA, Seaver E, Rouse GW, Obst M, Edgecombe GD et al. (2006). Broad phylogenomic sampling improves resolution of the animal tree of life. Nature 452: 745–749.
• Foottit RG, Maw HEL, von Dohlen CD, Hebert PDN (2008). Species identification of aphids (Insecta: Hemiptera: Aphididae) through DNA barcodes. Mol Ecol Resour 8: 1189–1201.
• Guindon S, Dufayard JF, Lefort V, Anisimova M, Hordijk W, Gascuel O (2010). New algorithms and methods to estimate maximumlikelihood phylogenies: assessing the performance of PhyML 0. Syst Biol 59: 307–321.
• Hall TA (2004). BioEdit Sequence Alignment Editor 7.0.1. Carlsbad, CA, USA: Isis Pharmaceuticals.
• Heie OE (1980). The Aphidoidea of Fennoscandia and Denmark. I. Fauna Entomologica Scandinavica 9: 1–236.
• Heie OE (1987). Paleontology and phylogeny. In: Minks AK, Harrewijn P, editors. Aphids: Their Biology, Natural Enemies and Control. Amsterdam, the Netherlands: Elsevier, pp. 367– 3
• Huang XL, Xiang-Yu JG, Ren SS, Zhang RL, Zhang YP, Qiao GX (2012). Molecular phylogeny and divergence times of Hormaphidinae (Hemiptera: Aphididae) indicate Late Cretaceous tribal diversification. Zool J Linn Soc-Lond 165: 73–
• Inbar M, Wink M, Wool D (2004). The evolution of host plant manipulation by insects: molecular and ecological evidence from gall-forming aphids on Pistacia. Mol Phylogenet Evol 32: 504–511.
• Martínez-Torres D, Buades C, Latorre A, Moya A (2001). Molecular systematics of aphids and their primary endosymbionts. Mol Phylogenet Evol 20: 437–449.
• Nei M, Kumar S (2000). Molecular Evolution and Phylogenetics. Oxford, UK: Oxford University Press.
• Nieto-Nafría JM, Mier-Durante MP, Pérez Hidalgo N (2011). Register of family-group taxa of Aphidoidea. In: Nieto-Nafría JM, Favret C, editors. Registers of Family-Group and GenusGroup Taxa of Aphidoidea (Hemiptera Sternorrhyncha). León, Spain: Universidad de León, Area de Publicaciones, pp. 21–80.
• Normark BB (1999). Evolution in a putatively ancient asexual aphid lineage: recombination and rapid karyotype change. Evolution 53: 1458–1469.
• Ortiz-Rivas B, Martínez-Torres D (2010). Combination of molecular data support the existence of three main lineages in the phylogeny of aphids (Hemiptera: Aphididae) and the basal position of the subfamily Lachninae. Mol Phylogenet Evol 55: 305–317.
• Ortiz-Rivas B, Moya A, Martínez-Torres D (2004). Molecular systematics of aphids (Homoptera: Aphididae): new insights from the long-wavelength opsin gene. Mol Phylogenet Evol 30: 24–
• Posada D (2008). jModelTest: Phylogenetic model averaging. Mol Biol Evol 25: 1253–1256.
• Rambaut A (2009). FigTree 1.3.1. Available online at http://tree.bio. ed.ac.uk/software/figtree/.
• Rannala B, Yang ZH (2008). Phylogenetic inference using whole genomes. Annu Rev Genom Hum G 9: 217–231.
• Remaudière G, Remaudière M (1997). Catalogue des Aphididae du Monde. Homoptera Aphidoidea. Paris, France: INRA.
• Ren SS, Jiang LY, Qiao GX (2006). Survey of aphids phylogeny. Acta Zootaxonomica Sin 31: 304–310.
• Ronquist F, Huelsenbeck JP (2003). MRBAYES 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19: 1572–1574.
• Sano M, Akimoto S (2011). Morphological phylogeny of gall-forming aphids of the tribe Eriosomatini (Aphididae: Eriosomatinae). Syst Entomol 36: 607–627.
• Swofford DL (2003). PAUP*. Phylogenetic Analysis Using Parsimony (*and Other Methods). Version 4. Sunderland, MA, USA: Sinauer Associates.
• Tamura K, Dudley J, Nei M, Kumar S (2007). MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol 24: 1596–1599. von Dohlen CD, Kurosu U, Aoki, S (2002). Phylogenetics and evolution of the eastern Asian-eastern North American disjunct aphid tribe, Hormaphidini (Hemiptera: Aphididae). Mol Phylogenet Evol 23: 257–267. von Dohlen CD, Moran NA (2000). Molecular data support a rapid radiation of aphids in the Cretaceous and multiple origins of host alternation. Biol J Linn Soc 71: 689–717.
• Xia X, Xie Z (2001). DAMBE: Data Analysis in Molecular Biology and Evolution. J Hered 92: 371–373.
• Xia X, Xie Z, Salemi M, Chen L, Wang Y (2003). An index of substitution saturation and its application. Mol Phylogenet Evol 26: 1–7.
• Zhang GX, Chen XL (1999). Study on the phylogeny of Pemphigidae (Homoptera: Aphidinea). Acta Entomol Sin 42: 176–183.
• Zhang GX, Qiao GX, Zhong TS, Zhang WY (1999). Fauna Sinica Insecta, Vol. 14. Homoptera: Mindaridae and Pemphigidae. Beijing, China: Science Press.
• Zhang HC, Qiao GX (2007a). Molecular phylogeny of Fordini (Hemiptera: Aphididae: Pemphiginae) inferred from nuclear gene EF-1α and mitochondrial gene COI. B Entomol Res 97: 379–386.
• Zhang HC, Qiao GX (2007b). Systematic status of the genus Formosaphis Takahashi and the evolution of galls based on the molecular phylogeny of Pemphigini (Hemiptera: Aphididae: Eriosomatinae). Syst Entomol 32: 690–699.
• Zhang HC, Qiao GX (2008). Molecular phylogeny of Pemphiginae (Hemiptera: Aphididae) inferred from nuclear gene EF-1α sequences. B Entomol Res 98: 499–507.
• Appendix. The list of samples according to the 3 tribes of Eriosomatinae and the out-groups. The GenBank accession numbers of each gene are presented. The sampling information of the downloaded sequences is missing. Species name Sample number Collecting locality Collecting date GenBank accession numbers COI COII EF-1α LWO Tetraneura sp. 22389 MONGOLIA: Ulan Bator 22 June 2009 JQ916865 JX536380 JX559469 JX559406 Tetraneura sp. 22400
• Beijing City (Changping District) 4 July 2009 JQ916866 JX536381 JX559470 JX559407 Tetraneura sp. 22926
• Gansu Province (Yuzhong County) 24 May 2009 JQ916872 JX536369 JX559475 JX559412 Tetraneura sp. 23047
• Gansu Province (Maiji Mountain) 2 June 2009 JQ916881 JX536375 JX559481 JX559418 Tetraneura sp. 23081
• Gansu Province (Maiji Mountain) 3 June 2009 JQ916885 JX536379 JX559484 JX559421 Tetraneura sp. 16999
• Zhejiang Province (Putuo Mountain) 29 May 2005 JX536321 JX536384 JX559487 Kaltenbachiella sp. 23140
• Sichuan Province (Meigu County) 10 June 2009 JX536308 JX536363 JX559488 JX559425 Eriosoma lanigerum 15412
• Tibet (Linzhi Prefecture) 21 August 2003 JQ916894 JX536354 JX559489 JX627604 Eriosoma sp. 22383 MONGOLIA: Ulan Bator 22 June 2009 JX536311 JX536357 JX559426 Eriosoma sp. 22920
• Gansu Province (Yuzhong County) 24 May 2009 JX536312 JX559490 JX559427 Eriosoma sp. 23044
• Gansu Province (Tianshui City) 2 June 2009 JX536316 JX536360 JX559432 Eriosoma sp. 23142
• Sichuan Province (Meigu County) 10 June 2009 JX536318 JX536359 JX559495 JX559435 Colophina arctica 23540
• Beijing City (Miyun County) 1 August 2005 JQ916891 JX536364 JX559436
• Fomosaphis micheliae 18074
• Fujian Province (Wuyi Mountain) 22 October 2005 JQ916862 JX536332 DQ779152 JX559437 Prociphilus pini 16169
• Beijing City (Miyun County) 13 May 2005 JQ916861 JX536327 DQ779159 JX559438
• Prociphilus ligustrifoliae 18235
• Yunnan Province (Lijiang City) 27 April 2006 JQ916897 JX627587 JX627602 JX627606
• Prociphilus ligustrifoliae 22989
• Gansu Province (Wudu County) 28 May 2009 JQ916876 JX536328 JX559496 JX559439
• Prociphilus ligustrifoliae 23043
• Gansu Province (Tianshui City) 2 June 2009 JQ916880 JX536329 JX559497 JX559440 Prociphilus sp. Y8936
• Hebei Province (Renqiu City) 3 July 2010 JX536290 JX536331 JX559441 Prociphilus kuwanai 24365
• Henan Province (Miyang Conunty) 9 May 2010 JX536291 JX536330 JX559498 Prociphilus caryae EU701858 DQ005163 DQ005161 Thecabius beijingensis 15739
• Heilongjiang Province (Mohe County) 31 July 2004 JX536307 JX536386 JX559501 JX559444
• Epipemphigus yunanensis 18234
• Yunnan Province (Lijiang City) 27 April 2006 JX627585 JX627601 JX627605
• Epipemphigus imaicus Sichuan Province (Meigu County) 9 June 2009 JX536303 JX559450
• Pachypappa marsupialis DQ005162 DQ005135 Pemphigus poluli AY522907 AM748713 FM163603 Pemphigus monophagous EU701836 AY182300 DQ779155 Species name Sample number Collecting locality Collecting date GenBank accession numbers COI COII EF-1α LWO
• Pemphigus populi-transversus EU701844 AM748720 DQ779157 Pemphigus tibetensis 18325 Tibet (Linzhi Prefecture) 22 August 2005 JX536340 JX559451
• Pemphigus borealis 23096 Sichuan Province (Louji Mountain) 5 June 2009 JX536297 JX536343 JX559514 JX559460
• Pemphigus bursarius 23097 Sichuan Province (Louji Mountain) 6 June 2009 JX536338 JX559515 JX559461
• Kaburagia rhusicola 15699 Shaanxi Province (Xixiang County) 26 June 2004 JQ916893 JX536323 DQ499612 JX559465
• Schlechtendalia chinensis 15703 Sichuan Province (Emei Mountain) 2 September 2004 JQ916860 JX536326 DQ499619 JX559468
• Chaitogeioca sp. 15300 Shaanxi Province (Qishan County) 14 July 2004 JX536320 JX536385 JX559517 Aploneura lentisci AY227083 AY227092 DQ499605 AJ489289
• Forda formicaria AY227076 AF454629 DQ499608 AM996874
• Forda marginata EU701668 AY227098 DQ499609 FM177108
• Melaphis rhois EU701748 FJ215686 FJ215685 Schlechtendalia chinensis JF7001701 AF454628 EU363670 Baizongia pistaciae AY227079 AY227093 DQ499606 AJ489290
• Paracletus cimiciformis AY227089 AY227102 FM163597 FM177109
• Geoica utricularia AY227096 FM163600 FM177110
• Smynthurodes betae AY227078 AF454630 FM163598 FM177111
• Slavum wertheimae AY227077 AY227103 DQ499616 Floraphis choui EU363665 EU363668 Floraphis meitanensis EU363666 EU363669 Nurudea shiraii AF454627 EU363679 Nurudea yanoniella EU363667 EU363680 Meitanaphis flavogallis EU363663 EU363673 Meitanapphis microgallis EU363664 EU363674 Hormaphis similibetulae 13549 Tibet (Linzhi Prefecture) 5 July 2002 JQ920920 JX627589 JX627595 JX627608
• Ktenopteryx eosocallis 14438 Fujian Province (Wuyi Mountain) 7 July 2003 JQ920921 JX627590 JX627596 JX627609
• Ceratoglyphina bambusae 14466 Fujian Province (Wuyi Mountain) 10 July 2003 JX627586 JX627588 JX627594 JX627607
• Phloeomyzus passerinii 14260 Tibet (Lasa City) 24 August 2003 JQ920929 JX627591 JX627597 JX627611
• Mindarus keteleerifoliae 18171 Yunnan Province (Kunming City) 22 April 2006 JQ920925 JX627600 JX627610
• Mindarus abietinus FJ668265 FM174703 FM177107 Anoecia sp. FM174706 AJ539463 Nipponaphis distyliicola GU978809 AF454626 AF454614 Kurisakia querciphila GU978801 JQ418320 Thelaxes suberi FM174702 AJ489287
• Phylloxerina salicis Yunnan Province (Kunming) 21 April 2006 JQ920928 Pineus armandicola 18168 Yunnan Province (Kunming) 22 April 2006 JQ920909 JX627593 JX627599 Adelges laricis FJ502430 DQ256142 DQ493827 Daktulosphaira vitifoloae AF307423 AF307423 EF073221 AJ489295